circad | circRNAs associated with diseases

circRNA_Atp9b/circ_15898
Gene	ATP9B	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Osteoarthritis (OA)	ICD-10	Polyarthrosis, unspecified (M15.9)
DBLink	Link to database	PMID	29305974
Experimental Method
Sample Type	Mouse Articular Chondrocytes (MACs)	Comparison	mouse chondrocytes with and without IL-1β stimulation
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GAACTTGGCAGTCTGCGAGTAA Reverse CTGGTATTGTGCTGGTCCGA	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Zhou, ZB, Du, D, Huang, GX, Chen, A, Zhu, L (2018). Circular RNA Atp9b, a competing endogenous RNA, regulates the progression of osteoarthritis by targeting miR-138-5p. Gene, 646:203-209.